View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15252_low_5 (Length: 306)
Name: NF15252_low_5
Description: NF15252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15252_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 26 - 235
Target Start/End: Complemental strand, 3684031 - 3683822
Alignment:
| Q |
26 |
aaaaaattacttgattcaatatttcgaccataaatatttgctaaacaaaaaa-tgtgaaaatgggaaaacatcttgtttgattgacaagcacatagtatc |
124 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3684031 |
aaaaaattacctgattcaatatttcgaccataaatatttgctaaacaaaaaaatgtgaaaaagggaaaacatcttatttgattgacaagcacagagtatc |
3683932 |
T |
|
| Q |
125 |
tgagcaatgaggatcaacannnnnnnnnaggggagggggcatacactttggaggtggtagaataaattgaaacattattatgattttggggtttaagcaa |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3683931 |
tgagcaatgaggatcaaca-ttttttttaggggagggggcatacacgttggaggtggtagaataaattgaaacattattatgattttggggtttgagcaa |
3683833 |
T |
|
| Q |
225 |
gaaatgtatga |
235 |
Q |
| |
|
|||||||||| |
|
|
| T |
3683832 |
caaatgtatga |
3683822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 290
Target Start/End: Complemental strand, 3683802 - 3683764
Alignment:
| Q |
252 |
gttaacccatcagttctaagggaaaactttggtaatacg |
290 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3683802 |
gttaacccatcagttttaagggaaaactttggtaatacg |
3683764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University