View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15252_low_5 (Length: 306)

Name: NF15252_low_5
Description: NF15252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15252_low_5
NF15252_low_5
[»] chr8 (2 HSPs)
chr8 (26-235)||(3683822-3684031)
chr8 (252-290)||(3683764-3683802)


Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 26 - 235
Target Start/End: Complemental strand, 3684031 - 3683822
Alignment:
26 aaaaaattacttgattcaatatttcgaccataaatatttgctaaacaaaaaa-tgtgaaaatgggaaaacatcttgtttgattgacaagcacatagtatc 124  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| ||||||    
3684031 aaaaaattacctgattcaatatttcgaccataaatatttgctaaacaaaaaaatgtgaaaaagggaaaacatcttatttgattgacaagcacagagtatc 3683932  T
125 tgagcaatgaggatcaacannnnnnnnnaggggagggggcatacactttggaggtggtagaataaattgaaacattattatgattttggggtttaagcaa 224  Q
    |||||||||||||||||||         |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3683931 tgagcaatgaggatcaaca-ttttttttaggggagggggcatacacgttggaggtggtagaataaattgaaacattattatgattttggggtttgagcaa 3683833  T
225 gaaatgtatga 235  Q
     ||||||||||    
3683832 caaatgtatga 3683822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 290
Target Start/End: Complemental strand, 3683802 - 3683764
Alignment:
252 gttaacccatcagttctaagggaaaactttggtaatacg 290  Q
    ||||||||||||||| |||||||||||||||||||||||    
3683802 gttaacccatcagttttaagggaaaactttggtaatacg 3683764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University