View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15253_low_10 (Length: 230)
Name: NF15253_low_10
Description: NF15253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15253_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 11083349 - 11083162
Alignment:
| Q |
20 |
atcatcaatttcactacccaaaaacacaatcctctccctcaacaacaaccccatagtatcagattcagcacctctgatagcccgttccggcgtctgcggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11083349 |
atcatcaatttcactacccaaaaacacaatcctctccctcaacaacaaccccatagtatcagattcagcacctctgatagcccgttccggcgtctgcggc |
11083250 |
T |
 |
| Q |
120 |
gaagacagttgaaaagtgatactgggtttttgaagttgggggttaaagtttggatttttggaaggacttggagatggggttgtgagaacgcagt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11083249 |
gaagacagttgaaaagtgatactgggtttttgaagttgggggttaaagtttggatttttggaa------ggagatggggttgtgagaacgcagt |
11083162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University