View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15253_low_3 (Length: 432)
Name: NF15253_low_3
Description: NF15253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15253_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 25 - 271
Target Start/End: Complemental strand, 51794969 - 51794723
Alignment:
| Q |
25 |
gcttgtacacactttagactgtgtcatgtcatggttctaagtgaaaaatgcttcgtgaggatatttgaattaacgtggtgatannnnnnngttgatggga |
124 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51794969 |
gcttgtaaacactttagactgtgtcatgtcatggttctaagtgaaaaatgcttcgtgaggatatttgaattaacgtggtgatatttttttgttgatggga |
51794870 |
T |
 |
| Q |
125 |
cgttaaattgcttaaatgaatgaatattacacaaataaaaaattgtgtgaacgaagagaagtggaaacctagagggagcttgggttcatgggatgtgata |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51794869 |
tgttaaattgcgtaaatgaatgaatattacacaaataaaaaattgtgtgaacgaagagaagtggaaacctagagggagcttgggttcatgggatgtgata |
51794770 |
T |
 |
| Q |
225 |
tgcgagtagatcgtttgtatttcttaaatagaggtttaatatataat |
271 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51794769 |
tgcgagtagatcgtttgtatttctcaaatagaggtttaatatataat |
51794723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University