View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15253_low_9 (Length: 252)
Name: NF15253_low_9
Description: NF15253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15253_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 15 - 174
Target Start/End: Complemental strand, 40847802 - 40847643
Alignment:
| Q |
15 |
cagagacgtgtaacatatggccagagcaataactgaatataggcatcattggctctaatacttcatgagacaacatccatagcataagccaaacaaaaag |
114 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40847802 |
cagaaacgtgtaacatatggcaagagcaataactgaatataggcatcattggctctaatacttcatgaaacaacatccatagcataagccaaacaaaaag |
40847703 |
T |
 |
| Q |
115 |
gcttctggtggttacgatattattacaagacgcaagtactttacggaaaataaggaaaaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || |||||||||||| ||||| |
|
|
| T |
40847702 |
gcttctggtggttacgatattattacaagacataagtaattcacggaaaataagaaaaaa |
40847643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 120 - 235
Target Start/End: Complemental strand, 40847389 - 40847274
Alignment:
| Q |
120 |
tggtggttacgatattattacaagacgcaagtactttacggaaaataaggaaaaacggttagtctcttagaacaccttaaatggtgcaacttggagtgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40847389 |
tggtggttacgatattattacaagacgcaagtactttacggaaaataaggaaaaaaggttagtctcttagaacaccttgaatggtgcaacttggagtgtt |
40847290 |
T |
 |
| Q |
220 |
ttacacgggatccact |
235 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
40847289 |
ttacacgggattcact |
40847274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University