View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_38 (Length: 353)
Name: NF15254_high_38
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 53 - 334
Target Start/End: Complemental strand, 3896317 - 3896036
Alignment:
| Q |
53 |
aaataattagcttcaaatttaagaagtattgcatagcaaaataatttttacttagaatgcatatcaggctatgtttcaagtaacagtgtaggttttcaac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| | |
|
|
| T |
3896317 |
aaataattagcttcaaatttaagaagtattgcatggcaaaataatttttacttagaatgcatatcaggctatgtttcaagaaactgtgtaggttttcagc |
3896218 |
T |
 |
| Q |
153 |
acattcagaaagtcggcactgttaagaaaggacaaaatgccacactcttgctagtcgaatgattaagattgtatcattagaagtcaatggattgtagtct |
252 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3896217 |
acatttagaaagtcagcactgttaagaaaggacaaaatgccacactcttgctagttgaatgcttaagattgtatcattagaagtcaatgggttgtagtct |
3896118 |
T |
 |
| Q |
253 |
taccggtaatgttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaa |
334 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3896117 |
tactggtaatgttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaa |
3896036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 241 - 334
Target Start/End: Original strand, 41600471 - 41600564
Alignment:
| Q |
241 |
ggattgtagtcttaccggtaatgttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaa |
334 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||| | ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41600471 |
ggattgtagtcttacaggcaatgttgtccacctttttctgatttcaccaagctcttgtctttctttttcacccccaccaaaataacaacctgaa |
41600564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University