View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_46 (Length: 302)
Name: NF15254_high_46
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 41421679 - 41421411
Alignment:
| Q |
18 |
atcaggtatagtatatatcaagctttgagtttcacgttcaaactttagagaacttgcataagtattatgcattaattttttagctctaaattctaattca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41421679 |
atcaggtatagtatatatcaagctttgagtttcacgttcaaactttagagaacttgcataagtattatgcattaattttttagctctaaattctaattca |
41421580 |
T |
 |
| Q |
118 |
attatttttatatttgcagcttactgctgatttggttcaaaattggataatgagtaacccagaagcctcaatttgtactctagaaggagtacacaatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41421579 |
attatttttatatttgcagcttactgctgatttggttcaaaattggataatgagtaacccagaagcctcaatttgtactctagaaggagtacacaatttc |
41421480 |
T |
 |
| Q |
218 |
aaagaaatggctaattttcaggattatcatggtctaccagagttcagaaatgtgagtggtgataatagt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41421479 |
aaagaaatggctaattttcaggattatcatggtctaccagagttcagaaatgtgagtggtgataatagt |
41421411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University