View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_52 (Length: 278)
Name: NF15254_high_52
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 263
Target Start/End: Complemental strand, 14982238 - 14981984
Alignment:
| Q |
9 |
gaagaatatgtcccaacaactgtcattttgtcatgtttttcgagctcgtcatttgaagatattccgatgctccctgtgcgtatgaattcagctatgctgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14982238 |
gaagaatatgtcccaacaactgtcattttgtcatgtttttcgacctcgtcatttgaagatattccgatgctccctgtgcgtatgaattcagctatgctgc |
14982139 |
T |
 |
| Q |
109 |
ataagagatcgttctcaaactcaacatcatctttgtggatatcgcggtatccataccgcactatgcaacgatagattctgaaattccgcggaccaacacg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14982138 |
ataagagatcgttctcaaactcaacatcatctttgtggatatcgcggtatccataccgcactatgcaacgatagattctgaaattccgcggaccaacacg |
14982039 |
T |
 |
| Q |
209 |
gccgactagaaatctttcctcgggtctaacgtgcggaacgggcacgtgtttgatg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14982038 |
gccgactagaaatctttcctcgggtctaacgtgcggaacgggcacatgtttgatg |
14981984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 9 - 263
Target Start/End: Complemental strand, 15028778 - 15028532
Alignment:
| Q |
9 |
gaagaatatgtcccaacaactgtcattttgtcatgtttttcgagctcgtcatttgaagatattccgatgctccctgtgcgtatgaattcagctatgctgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
15028778 |
gaagaatatgtcccaacaactgtcatttt--------tttcgagctcgtcgtttgaagatattccgatgctccctgtacgtatgaattcggctatgctgc |
15028687 |
T |
 |
| Q |
109 |
ataagagatcgttctcaaactcaacatcatctttgtggatatcgcggtatccataccgcactatgcaacgatagattctgaaattccgcggaccaacacg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||| || || |
|
|
| T |
15028686 |
ataagagatcgttctcaaactcaacatcatctttgtggatattgcggtatcaataccgcactatgcaacgatagattctgaaattctgcggacctacgcg |
15028587 |
T |
 |
| Q |
209 |
gccgactagaaatctttcctcgggtctaacgtgcggaacgggcacgtgtttgatg |
263 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
15028586 |
gccgactacaaatctttcctcgggtctaatgtgcggaactggcacatgtttgatg |
15028532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University