View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_57 (Length: 252)
Name: NF15254_high_57
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_57 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 32 - 237
Target Start/End: Original strand, 102487 - 102692
Alignment:
| Q |
32 |
tggttgcggtgatggattggttttgttgttctcggtcaaccactgtcgacgtgccacggtggtcgattcttgttggtgatttttgttgatacaaaactag |
131 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
102487 |
tggttgcggtgacgaattggtttttttgttctcggtcaaccaccgtcgacgtgccacggtgttcgattcttgttggtgatttttgttgatacaaaactag |
102586 |
T |
|
| Q |
132 |
ggggaagcagcaacctcatcctgttcttgttgccattttggtgtctcaatgcggcgaccagccaagccgccttttggttcaggcaaaaaatcggaaaggg |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
102587 |
ggggaagcagcaacctcatcttgttcttgttgccattttggcctctcaatgcggcgactagccaaaccgccttttggtgcaggcaaaaaatcggaaaggg |
102686 |
T |
|
| Q |
232 |
tctgtg |
237 |
Q |
| |
|
|||||| |
|
|
| T |
102687 |
tctgtg |
102692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University