View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_60 (Length: 246)
Name: NF15254_high_60
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 29016724 - 29016502
Alignment:
| Q |
6 |
aattaaaaacaaaggtcaatgttgttgtttttgattcacaacatcaacactagtgccacatgacaagaacttatgaaacatccgaaacaaagtattacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29016724 |
aattaaaaacaaaggtcaatgttgttgtttttgattcacaacatcaacactagtgccacatgacaagaacttatgaaacatccgaaacaaagtattacaa |
29016625 |
T |
 |
| Q |
106 |
gaaatttccttcattttacttaaaaccaaacacttattccttcttctactttgatttcttttcttctttccatcatgatccactttctctctcaccctac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29016624 |
gaaatttccttcattttacttaaaaccaaacacttattccttcttctactttgatttcttttcttctttccatcatgatccactttctctctcaccctac |
29016525 |
T |
 |
| Q |
206 |
caaaacatttttgggttttttct |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29016524 |
caaaacatttttgggttttttct |
29016502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University