View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_62 (Length: 242)
Name: NF15254_high_62
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 37109417 - 37109617
Alignment:
| Q |
19 |
ggggatcactgtcatagatgattcaaatacaatattaccgaatgatttgctcgttaatctttttatacttttactccatgttttgtgttgaaacgttgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37109417 |
ggggatcactgtcatagatgattcaaatacaatattaccgaatgatttgctcgttaatcttt---------tactccatgttttgtgttgaaacgttgct |
37109507 |
T |
|
| Q |
119 |
ataagtaggatcatagtcactgtctgtttaggccatatctaggataacagatcatggacaaattattactgaatcattgcaatgatcagtcaaatatgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37109508 |
ataagtaggatcatagtcactgtctgtttaggccatatctaggataacagatcatggacaaattattactgaatcattgcaatgatcagtcaaatatgtc |
37109607 |
T |
|
| Q |
219 |
tgaaactttt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
37109608 |
tgaaactttt |
37109617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University