View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_63 (Length: 240)
Name: NF15254_high_63
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 27243963 - 27244046
Alignment:
| Q |
1 |
ttttcttgatgatggttgaaaaatcaatctaaagacttccactgatttgaatcattggttaattcatctgcttagtgtttatga |
84 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243963 |
ttttcttgatgatggttgaaaaatcagtctaaggacttccactgatttgaatcattggttaattcatctgcttagtgtttatga |
27244046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 180 - 240
Target Start/End: Original strand, 27244144 - 27244204
Alignment:
| Q |
180 |
cgaaaatgttgtatttaacgaaaataatttcgtgaaagatagcaaacaaatgtattgttac |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27244144 |
cgaaaatgttgtatataacgaaaataatttcgtgaaagatagcgaacaaatgtattgttac |
27244204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University