View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_high_73 (Length: 209)
Name: NF15254_high_73
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_high_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 13 - 137
Target Start/End: Original strand, 6080677 - 6080801
Alignment:
| Q |
13 |
atttatgtgtttaagttttgggtttaaatttgggtttatatccttgnnnnnnn-agaactcattgagcatatgttttcaaatgagtttgtaggatttttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6080677 |
atttatgtgtttaagttttgggtttaaatttgggtttatatccttgttttttttagaactcattgagcatatgttttcaaatgagtttgtaggatttttt |
6080776 |
T |
 |
| Q |
112 |
atgggttctttgttcatagaaataga |
137 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
6080777 |
atgggttctttgttc-tagaaataga |
6080801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University