View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_low_58 (Length: 256)
Name: NF15254_low_58
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 116 - 242
Target Start/End: Complemental strand, 40961770 - 40961644
Alignment:
| Q |
116 |
tatttgttaactttttataacgcctacatcaaattcaaatcatcttacaaggatcataaataaattgttctttattggaggggaattaattaacttggtt |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40961770 |
tatttgttaattttttataacgcctacatcaaattcaaatcatcttacaaggatcataaataaattgttctttattggaggggaattaattaacttggtt |
40961671 |
T |
|
| Q |
216 |
aattttctaggtccaggatgttcctct |
242 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
40961670 |
aattttctaggtccgggatgttcctct |
40961644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University