View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_low_64 (Length: 245)
Name: NF15254_low_64
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_low_64 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 1304080 - 1304307
Alignment:
| Q |
18 |
tggaagaagaaactccgatgctgcggagattttgtattcgttgaagaagcttttcatcggaaatgagaaagagaaacggacttcgtcggaggtggaagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1304080 |
tggaagaagaaactccgatgctgcggagattttgtattcgttgaagaagcttttcatcggaaatgagaaagagaaatggacttcgtcggaggtggaagac |
1304179 |
T |
|
| Q |
118 |
gatctggattcgattccggcggagtcgtattgtttctggactccaaaatcatcatctccgattgcttctccgaaaaattctccgatgaattctacgatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1304180 |
gatctggattcgattccggcggagtcgtattgtttctggactccaaaatcatcatctctgattgcttctccgaagacttctccgatgaattctacgatca |
1304279 |
T |
|
| Q |
218 |
aatgtaagaaaagcaattcaactggttc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1304280 |
aatgtaagaaaagcaattcaactggttc |
1304307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 158
Target Start/End: Original strand, 1293502 - 1293649
Alignment:
| Q |
20 |
gaagaagaaactccgatgctgcggagattttgtattcgttgaagaagcttttcatcggaaatgagaaagagaaacgga---------cttcgtcggaggt |
110 |
Q |
| |
|
||||||||||||| |||| |||||||||| | ||||||||||||| || || |||||||||||||||||| |||||| ||||||| ||| | |
|
|
| T |
1293502 |
gaagaagaaactctgatgtggcggagatttcgaattcgttgaagaaactgtttatcggaaatgagaaagaggaacggaaccgtgtaccttcgtcagagtt |
1293601 |
T |
|
| Q |
111 |
ggaagacgatctggattcgattccggcggagtcgtattgtttctggac |
158 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
1293602 |
ggaagacgatctggattcgattccagcggagacgtattgtttgtggac |
1293649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University