View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15254_low_69 (Length: 236)

Name: NF15254_low_69
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15254_low_69
NF15254_low_69
[»] chr2 (2 HSPs)
chr2 (10-98)||(26834777-26834865)
chr2 (148-219)||(26834659-26834730)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 26834865 - 26834777
Alignment:
10 gacatcatcaacttttgcattctcaggtaacctaaattctttcatgaacacaccattgttccttctctccttgcaatgccacttgagac 98  Q
    |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||    
26834865 gacatcatcaacttttgcattctccggtaacctaaattccttcatgaacacaccattgttctttctctccttgcaatgccacttgagac 26834777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 26834730 - 26834659
Alignment:
148 gatgcagagtactctgttttcatgcaattcaagcttcacatcctctttagtgaatccgggaagatcgaattg 219  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||    
26834730 gatgcagagtactctgttttcatgcaattcaagcttcaaatcctctttggtgaacccgggaagatcgaattg 26834659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University