View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15254_low_69 (Length: 236)
Name: NF15254_low_69
Description: NF15254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15254_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 26834865 - 26834777
Alignment:
| Q |
10 |
gacatcatcaacttttgcattctcaggtaacctaaattctttcatgaacacaccattgttccttctctccttgcaatgccacttgagac |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26834865 |
gacatcatcaacttttgcattctccggtaacctaaattccttcatgaacacaccattgttctttctctccttgcaatgccacttgagac |
26834777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 26834730 - 26834659
Alignment:
| Q |
148 |
gatgcagagtactctgttttcatgcaattcaagcttcacatcctctttagtgaatccgggaagatcgaattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26834730 |
gatgcagagtactctgttttcatgcaattcaagcttcaaatcctctttggtgaacccgggaagatcgaattg |
26834659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University