View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15255_low_14 (Length: 247)
Name: NF15255_low_14
Description: NF15255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15255_low_14 |
 | |
|
| [»] scaffold0444 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 100 - 231
Target Start/End: Original strand, 30183744 - 30183875
Alignment:
| Q |
100 |
taataagggagcaaatatattggtaatgtaatgtaatgaattaataatttcaaacaaaagacagttacggactgggattactttttaattaatggaaaat |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183744 |
taatatgggagcaaatatattggtaatgtaatgtaatgaattaataatttcaaacaaaagacagttacggactgggattactttttaattaatggaaaat |
30183843 |
T |
|
| Q |
200 |
gtgggtcagaaaacaagtcattgagttcactt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30183844 |
gtgggtcagaaaacaagtcattgagttcactt |
30183875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 44430947 - 44430879
Alignment:
| Q |
1 |
atgagtaagttgcgtcatgctttattttattaactagcttttgcatttcaaggaactggaatttcaccc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44430947 |
atgagtaagtcgcgtcatgctttattttattaactagcttttgcatttcaaggaactggaatttcaccc |
44430879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 30183002 - 30182953
Alignment:
| Q |
15 |
tcatgctttattttattaactagcttttgcatttcaaggaactggaattt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183002 |
tcatgctttattttattaactagcttttgcatttcaaggaactggaattt |
30182953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 44441352 - 44441300
Alignment:
| Q |
18 |
tgctttattttattaactagcttttgcatttc-aaggaactggaatttcaccc |
69 |
Q |
| |
|
||||| |||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
44441352 |
tgcttcattttattaactagctcttgcattccaaaggaactggaatttcaccc |
44441300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0444 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0444
Description:
Target: scaffold0444; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 6165 - 6113
Alignment:
| Q |
18 |
tgctttattttattaactagcttttgcatttc-aaggaactggaatttcaccc |
69 |
Q |
| |
|
||||| |||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
6165 |
tgcttcattttattaactagctcttgcattccaaaggaactggaatttcaccc |
6113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University