View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15255_low_17 (Length: 241)
Name: NF15255_low_17
Description: NF15255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15255_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 6169597 - 6169804
Alignment:
| Q |
15 |
cagagaggcgttcttaaaaaaccaacaatgcacttgtagagtggctttcaatgtcttaaaagtttaaattttatcttttcaatataaaacttggctttta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169597 |
cagagaggcgttcttaaaaaaccaacaatgcacttgtagagtggctttcaatgtcttaaaagtttaaattttatcttttcaatataaaacttggctttta |
6169696 |
T |
 |
| Q |
115 |
attcnnnnnnnnnnnnnngcgacgtgatataaggcaatgcagcaactgcattgtgcatgtatgctctcattcttcaccaagtataatttattcaccggag |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169697 |
attctttttttagtttttgcgacgtgatataaggcaatgcagcaactgcattgtgcatgtatgctctcattcttcaccaagtataatttattcaccggag |
6169796 |
T |
 |
| Q |
215 |
aattaaat |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
6169797 |
aattaaat |
6169804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University