View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15256_high_2 (Length: 338)
Name: NF15256_high_2
Description: NF15256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15256_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 3 - 216
Target Start/End: Complemental strand, 29426744 - 29426531
Alignment:
| Q |
3 |
cagagacagaagcaacgccggcatttcctatatccgtcgctgttaggttaaggttgtcacggattataggaacaagtggtgctgctgcaaagctagaaac |
102 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29426744 |
cagaaacagaagcaacaccggcatttcctatatccgtggctgttaggttaaggttgtcacggattataggaacaagtggtgctgctgcaaagctagaaac |
29426645 |
T |
 |
| Q |
103 |
aaagcatgcaaagaatgagaaccatgatagatgaaatgctagcatgtgaggttttgctattgagtggattttgaatatggttgatttgttttctgaatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29426644 |
aaagcatgcaaagaatgagaaccatgatagatgaaatgctagcatgtgaggttttgctattgagtggattttgaatatagttgatttgttttctgaatct |
29426545 |
T |
 |
| Q |
203 |
acggggagggagaa |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29426544 |
acggggagggagaa |
29426531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 178
Target Start/End: Complemental strand, 29440082 - 29439973
Alignment:
| Q |
72 |
gaacaagtggtgctgctgcaaagctagaaacaaagcatgcaaagaa-tgagaaccat--gatagatgaaatgctagcatgtgaggttttgctattgagtg |
168 |
Q |
| |
|
|||||||| ||| | |||||||| |||||||||| |||| ||| || | |||||||| ||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
29440082 |
gaacaagttgtgttcctgcaaagttagaaacaaaacatgtaaaaaaatcagaaccatatgatagattgaatgctagcttgtgaggtttagctattgagtg |
29439983 |
T |
 |
| Q |
169 |
gattttgaat |
178 |
Q |
| |
|
|||||||||| |
|
|
| T |
29439982 |
gattttgaat |
29439973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 324
Target Start/End: Complemental strand, 29426458 - 29426429
Alignment:
| Q |
295 |
ggctatgggagtgttgatttgtgttgaggt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29426458 |
ggctatgggagtgttgatttgtgttgaggt |
29426429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University