View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15258_high_1 (Length: 298)
Name: NF15258_high_1
Description: NF15258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15258_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 24 - 288
Target Start/End: Complemental strand, 25777901 - 25777638
Alignment:
| Q |
24 |
tcttatgcatatcctcagatctgcgatattaagtgatgaagaaaatgaggcattgatgttacacttgtaccttctagttgtcggtttctcccacttcacc |
123 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25777901 |
tcttatgcacatcctcagatctgtgatattaagtgatgaagataatgaggcattgatgttacacttgtaccttctagttgtcggtttctcccacttcacc |
25777802 |
T |
 |
| Q |
124 |
aaatctcagctgattgagatttgctggttcgtgatcgtagttgttgtactacgagactttaaacactgtgccactcttcaatattcatcctgcaagtggg |
223 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25777801 |
aaatctcagctgattgagatttaccagttcgtgatcgtagttgttgtactacgagactttaaacattgtgccactcttcaatattcatcctgcaagtggg |
25777702 |
T |
 |
| Q |
224 |
ttgctcatccaattacttgcgtgcttgttttgttctgtttgttgacaaattttcaggtttctgtg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25777701 |
ttgctcatccaattacttgcgtgcttgttttgttctg-ttgttgacaaattttcaggtttctgtg |
25777638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University