View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15258_low_3 (Length: 205)
Name: NF15258_low_3
Description: NF15258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15258_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 50 - 174
Target Start/End: Original strand, 36004965 - 36005097
Alignment:
| Q |
50 |
tgtgaccgccgttattatgtgtgggtgtcaaaagatgtatgccataaatggactgccg---------agattagctaaccctggaagaattgatataagg |
140 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
36004965 |
tgtgaccaccgttattatgtgtgggtgtcaaaagatgtatgtcataaatggactgccgctatagccgagatgagctaaccctggaagaattgatataagg |
36005064 |
T |
|
| Q |
141 |
acactggcgctaatgaacaaattgcgtggtccct |
174 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
36005065 |
acact-gcgctaatgaacaaattgcgtggtccct |
36005097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University