View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_1D_low_5 (Length: 251)
Name: NF1525_1D_low_5
Description: NF1525_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_1D_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 25 - 184
Target Start/End: Original strand, 9333575 - 9333735
Alignment:
| Q |
25 |
tcttgcacaacattatggaactttcatttgccatttttacgtcaaaacttctgt-gtaatactttacttctaaagatcagcctgctaagttgaataattg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9333575 |
tcttgcacaacattatggaactttcatttgccagttttacgtcaaaacttctgttgtaatactttacttctaaagatcaacctgctaagttgaataattg |
9333674 |
T |
|
| Q |
124 |
aaataaaatgaaacttgaaaaattgtctgttaagtggatgaattgaaagcataagcatcta |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9333675 |
aaataaaatgaaacttggaaaattgtctgttaagtggatgaattgaaagcataagcatcta |
9333735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 182 - 244
Target Start/End: Original strand, 41957869 - 41957931
Alignment:
| Q |
182 |
ctaaagtggcaaaatggaataatattcaacattaacttatcatatcctgatgtccatctcatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41957869 |
ctaaagtggcaaaatggaataatattcaacattaacttatcatatcctgatgtctgtctcatt |
41957931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University