View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_1D_low_6 (Length: 251)
Name: NF1525_1D_low_6
Description: NF1525_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_1D_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 23029316 - 23029232
Alignment:
| Q |
7 |
atgaatgattacggaacgaaaattactaattcaaaagaaacggttgcataaataaaactaggagatataacattagaatttaccc |
91 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23029316 |
atgaatgattacggaacgaaaattactagatcaaaagaaacggttgtataaataaaactactagctataacattagaatttaccc |
23029232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 23029163 - 23029091
Alignment:
| Q |
166 |
tggaggaaaggtttataaatcgatgtatatttgaataatgtgt----gtgagagaaagattttgtgaaggagg |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23029163 |
tggaggagaggtttataaatcgatgtatatttgaataatgtgtgagagagagagaaagattttgtgaaggagg |
23029091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University