View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_1D_low_7 (Length: 244)
Name: NF1525_1D_low_7
Description: NF1525_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_1D_low_7 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 244
Target Start/End: Original strand, 38522852 - 38523093
Alignment:
| Q |
3 |
gtagataattctggaacaacctgaaaaatcaaccatttagaatgtcacgaaaaatagttttaactagataacaatgcacacaaaaattagtagtgcgaca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38522852 |
gtagataattctggaacaacctgaaaaatcaaccatttagaatgtcacaaaaaatagttttaactagataacaatgcacacaaaaattagtagtgcgaca |
38522951 |
T |
|
| Q |
103 |
cagatgaatactcaataaatggaaaatagtttcataaaactgtacctccttcaacatgtaaataattgaatcaaaatctgtcccccttgccaaagatcct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38522952 |
cagatgaatactcaataaatggaaaatagtttcataaaactgtacctccttcaacatgtaaataattgaatcaaaatctgtcccccttgccaaagatctt |
38523051 |
T |
|
| Q |
203 |
gtagaagcagcctgaacagaaagacacatcagtttgagaatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38523052 |
gtagaagcagcctgaacagaaagacacatcagtttgagaatc |
38523093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 239
Target Start/End: Complemental strand, 41387422 - 41387303
Alignment:
| Q |
119 |
aaatggaaaatagtttcataaaactgtacctccttcaacatgtaaataattgaatcaaaatctgtcccccttgccaaagatcctgtagaagcagcctgaa |
218 |
Q |
| |
|
|||||| |||| |||||||| || | |||||| |||||||| |||||||||||||||||| |||||||||| |||| || ||||| ||||||||||| |
|
|
| T |
41387422 |
aaatggcaaatggtttcatagaaat-tacctcattcaacatagaaataattgaatcaaaattgctcccccttgctaaagctcgtgtagcagcagcctgaa |
41387324 |
T |
|
| Q |
219 |
cagaaagacacatcagtttga |
239 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
41387323 |
cagaaagacatgtcagtttga |
41387303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 88
Target Start/End: Complemental strand, 41388427 - 41388398
Alignment:
| Q |
59 |
gttttaactagataacaatgcacacaaaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41388427 |
gttttaactagataacaatgcacacaaaaa |
41388398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 162 - 244
Target Start/End: Original strand, 3300914 - 3300996
Alignment:
| Q |
162 |
aaataattgaatcaaaatctgtccccctt-gccaaagatcctgtagaagcagcctgaacagaaagacacatcagtttgagaatc |
244 |
Q |
| |
|
|||||||||||||||||| ||||||||| || ||||||| ||||| |||| || || |||||||||||||||||||||||||| |
|
|
| T |
3300914 |
aaataattgaatcaaaattggtccccctttgctaaagatcgtgtagcagcatccgga-cagaaagacacatcagtttgagaatc |
3300996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University