View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_1D_low_9 (Length: 229)
Name: NF1525_1D_low_9
Description: NF1525_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_1D_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 3006772 - 3006558
Alignment:
| Q |
8 |
gcaagaaggctattgatgtaaaatcgcactttagaatttcatgagcaatccctgaacaacttaatctagtagggctattctgatggtgactagtgtggag |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3006772 |
gcaagaaggctgttgatgtaaaatcgcactttagaatttcatgagcaatccctgaacaacttaatctagtaggactattctgatggtgactagtgtggag |
3006673 |
T |
 |
| Q |
108 |
ataaaattgataggaggagcacaattagttatgtgtttaaggtacaaggagatcgtatctcatggccatataagaagcaattaatggtttc-tttatcaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3006672 |
ataaaattgataggaggagcacaattagttatgtgtttaaggtacaaggagatcgtatctcatggccatataagaagcaattaatggtttcttttatcaa |
3006573 |
T |
 |
| Q |
207 |
gttatgaagaataat |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3006572 |
gttatgaagaataat |
3006558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University