View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_2D_low_13 (Length: 322)
Name: NF1525_2D_low_13
Description: NF1525_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_2D_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 34533804 - 34533512
Alignment:
| Q |
19 |
cgttgtcggggtcagctaacccttcgtacatcttcatcataggtggttttcgaaaagaccgaagcaaggttttatggtgactcttgtgaatgtttcgttc |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533804 |
cgttgttggggtcagctaacccttcgtacttcttcatcataggtggttttcgaaaagaccgaagcaaggttttatggtgactcttgtgaatgtttcgttc |
34533705 |
T |
|
| Q |
119 |
ttgaatatgttttcttcccggtcataaaattatagggtttgccaacatttcttccttgggcagttgatccctcctcccatgtcgccccttcgtaatgagg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533704 |
ttgaatatgttttcttcccggtcataaaattatagggcttgccaacatttcttccttgggcagttgatccctcctcccatgtcgccccttcgtaatgagg |
34533605 |
T |
|
| Q |
219 |
gggtcgattgatggttggacgagagtctgtgtctttgtggagccacaaatctccttacttctggagttctttctttctctttatttaattttg |
311 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533604 |
gggtcgattgatggtcggacgagagtctgcgtctttgtggagccacaaatctccttacttctggagttctttctttctctttatttaattttg |
34533512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University