View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1525_2D_low_18 (Length: 259)
Name: NF1525_2D_low_18
Description: NF1525_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1525_2D_low_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 259
Target Start/End: Original strand, 34533242 - 34533494
Alignment:
| Q |
8 |
gtttggtgtttatgttagaggagttttggtacgagcaacaagttgttgtttttaatgttggcactttatgttggagattagtgagtttgacttttgcttt |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
34533242 |
gtttggtggttatgttagaggagttttggtacgagcaacaagttgttgtttttaatgttggcactttacgttggagattagagagtttgacttttgcttt |
34533341 |
T |
 |
| Q |
108 |
tggagttgaaattgatttttgtgt-atagattttatggttttggtggtcgccttatgtagagggtgtttttggttggtttatcggatgttttattgtttg |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34533342 |
tggagttgaaattgatttttgtgtaatagattttatggttttggtggtagccctatgtagagggtgtttttggttggtttgtcggatgttttattgtttg |
34533441 |
T |
 |
| Q |
207 |
tgtcttgcttgtctctattcaccttgaatagggactttgtcttttaataaatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
34533442 |
tgtcttgcttgtctctattcaccttgaatagtgactttatcttttaataaatt |
34533494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University