View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15260_low_4 (Length: 634)
Name: NF15260_low_4
Description: NF15260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15260_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 2e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 47851902 - 47851806
Alignment:
| Q |
18 |
gaagttttcagaaaaattaaagtcgtatcatacatcattttcatcttctgcgctatatttcttattgtatgagagattgtttatctttcaattttag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851902 |
gaagttttcagaaaaattaaagtcgtatcatacatcattttcatcttctgcgctatatttcttattgtatgagagattgtttatctttcaattttag |
47851806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 552 - 623
Target Start/End: Complemental strand, 47851588 - 47851517
Alignment:
| Q |
552 |
attgactaagaccaaattggttcaggtggaagagcgcgttgttgctgtggatgaattgactgaagcagatga |
623 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47851588 |
attgattaagatcaaattggttcaggtggaagagcgcgttgttgctgtggatgaattgactgaggcagatga |
47851517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 524 - 553
Target Start/End: Complemental strand, 47851643 - 47851614
Alignment:
| Q |
524 |
attttggttagccaattttgctatttatat |
553 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47851643 |
attttggttagccaattttgctatttatat |
47851614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University