View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15261_low_4 (Length: 280)
Name: NF15261_low_4
Description: NF15261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15261_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 108 - 214
Target Start/End: Complemental strand, 32994850 - 32994744
Alignment:
| Q |
108 |
gtgaaacattgctcataatcagattcatgagagtatttaggaaccaagaggtaccttaatttgtcactctttgatctctcaaggataggagctgatcatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32994850 |
gtgaaacattgctcataatcagattcatgagagtattgaggaaccaagaggtaccttaatttgtcactctttgatctctcaaggataggagctgatcatg |
32994751 |
T |
|
| Q |
208 |
aaaaaca |
214 |
Q |
| |
|
||||||| |
|
|
| T |
32994750 |
aaaaaca |
32994744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University