View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15262_low_2 (Length: 372)

Name: NF15262_low_2
Description: NF15262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15262_low_2
NF15262_low_2
[»] chr8 (2 HSPs)
chr8 (18-153)||(29235819-29235954)
chr8 (43-153)||(29280577-29280687)
[»] chr2 (1 HSPs)
chr2 (93-133)||(40030312-40030352)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 29235819 - 29235954
Alignment:
18 aatttgaaattaccttactgatctggaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgtt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
29235819 aatttgaaattaccttactgatctggaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttatt 29235918  T
118 cacacagttcaatgataatgcacatgcaattcagtt 153  Q
    ||||||||||||||||||||||||||||||||||||    
29235919 cacacagttcaatgataatgcacatgcaattcagtt 29235954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 43 - 153
Target Start/End: Original strand, 29280577 - 29280687
Alignment:
43 gaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgttcacacagttcaatgataatgcacat 142  Q
    |||||||| | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| || ||||||||| |||| || ||||||||||||    
29280577 gaaggatcgaaacaatgggaactggtggtttggatatggatctgaagtagttgggtattggccatcttccttgttcacaaagttgaaggataatgcacat 29280676  T
143 gcaattcagtt 153  Q
    | |||| ||||    
29280677 gaaattgagtt 29280687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 93 - 133
Target Start/End: Original strand, 40030312 - 40030352
Alignment:
93 ttgggtattggccatcctctttgttcacacagttcaatgat 133  Q
    |||| |||||||||||||||||||||||||| || ||||||    
40030312 ttggatattggccatcctctttgttcacacacttaaatgat 40030352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University