View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15262_low_2 (Length: 372)
Name: NF15262_low_2
Description: NF15262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15262_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 29235819 - 29235954
Alignment:
| Q |
18 |
aatttgaaattaccttactgatctggaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29235819 |
aatttgaaattaccttactgatctggaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttatt |
29235918 |
T |
 |
| Q |
118 |
cacacagttcaatgataatgcacatgcaattcagtt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29235919 |
cacacagttcaatgataatgcacatgcaattcagtt |
29235954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 43 - 153
Target Start/End: Original strand, 29280577 - 29280687
Alignment:
| Q |
43 |
gaaggatcaagacaatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgttcacacagttcaatgataatgcacat |
142 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| || ||||||||| |||| || |||||||||||| |
|
|
| T |
29280577 |
gaaggatcgaaacaatgggaactggtggtttggatatggatctgaagtagttgggtattggccatcttccttgttcacaaagttgaaggataatgcacat |
29280676 |
T |
 |
| Q |
143 |
gcaattcagtt |
153 |
Q |
| |
|
| |||| |||| |
|
|
| T |
29280677 |
gaaattgagtt |
29280687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 93 - 133
Target Start/End: Original strand, 40030312 - 40030352
Alignment:
| Q |
93 |
ttgggtattggccatcctctttgttcacacagttcaatgat |
133 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || |||||| |
|
|
| T |
40030312 |
ttggatattggccatcctctttgttcacacacttaaatgat |
40030352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University