View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15263_high_2 (Length: 481)
Name: NF15263_high_2
Description: NF15263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15263_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 6e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 245 - 465
Target Start/End: Original strand, 27621351 - 27621579
Alignment:
| Q |
245 |
taataaatagaggagtaatacatcatcacaagtacaacttgaagtactggacggtttcatagtgtgacacaacttgaagtgaatgagatgaggctccaca |
344 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27621351 |
taataaatagaggaggagtacatcatcacaagtacaacttgaagtactggacggtttcatagtg--acacaacttgaagtgaatgagatgaggctccaca |
27621448 |
T |
 |
| Q |
345 |
tgtcgaaagtaacatttaaaagaaatctgaaattaaa---------------ctatagctttttgacattacatgagttgagttgagttgttcacatttt |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27621449 |
tgtcgaaagtaacatttaaaagaaatctgaaattaaactatactccatcatgctatagctttttgacattaca-----tgagttgagttgttcacatttt |
27621543 |
T |
 |
| Q |
430 |
acatcaatcaatatactatgtcccctcaaaaagttt |
465 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27621544 |
acataaatcaatatactatgtcccctcaaaaagttt |
27621579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 208 - 246
Target Start/End: Original strand, 27621061 - 27621099
Alignment:
| Q |
208 |
gtgatagataaaatatcaagttgtaaattcgatatacta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27621061 |
gtgatagataaaatatcaagttgtaaattcgatatacta |
27621099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University