View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15263_low_10 (Length: 273)
Name: NF15263_low_10
Description: NF15263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15263_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 16510205 - 16509950
Alignment:
| Q |
1 |
ccagcttatgggttgtctcattacccttcctatccacaaagttaaatgacacatgtctgaatctagtggatctaaaccggataccccttatcacattgcc |
100 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16510205 |
ccagcttatgggctgcctcattacccttcctacccacaaagttaaaggacacatgtcttaatctagtggatctaaaccggataccccttatcacattgcc |
16510106 |
T |
|
| Q |
101 |
tacatatagattgggagtggtttcaatttcacgcagaaaccttacaattttctcacaatctgtttcaaaaactacatctaagaatccacattcaactgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16510105 |
tacatatagattgggagtggtttcaatttcacgcagaaaccttacaattttctcacaatctgtttcaaaaactacatctaagaatccacattcagctgca |
16510006 |
T |
|
| Q |
201 |
aattctaaagccatgtatactccaaacgcttcagctgctgttggatctgcaaaacc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16510005 |
aattctaaagccatgtatactccaaacgcttcagctgctgttggatctgcaaaacc |
16509950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University