View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15263_low_11 (Length: 249)
Name: NF15263_low_11
Description: NF15263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15263_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 29218712 - 29218832
Alignment:
| Q |
7 |
tcgaagaaaatcagaagccgggttctgaaattgagcgacactttggtctctttagacccgacaaatcacctaaatatcaaattagtttcaattgaaaaat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29218712 |
tcgatgaaaatcagaagccgggttctgaaattgagcgacactttggtctctttagacccgacaaatcacctaaatatcaaattagtttcaattgaaaaat |
29218811 |
T |
 |
| Q |
107 |
acaggtgatcggcgattatgt |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29218812 |
acaggtgatcggcgattatgt |
29218832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 198 - 232
Target Start/End: Original strand, 29218867 - 29218901
Alignment:
| Q |
198 |
ctcttatggttcaagttttagatgtttgtaccatt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29218867 |
ctcttatggttcaagttttagatgtttgtaccatt |
29218901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 29226071 - 29226125
Alignment:
| Q |
48 |
tttggtctctttagacccgacaaatcacctaaatatcaaattagtttcaattgaa |
102 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
29226071 |
tttggtctctttaatcctgacaaatcacctaaatatcaaataagcttcaattgaa |
29226125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 29241247 - 29241301
Alignment:
| Q |
48 |
tttggtctctttagacccgacaaatcacctaaatatcaaattagtttcaattgaa |
102 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
29241247 |
tttggtctctttaatcctgacaaatcatctaaatatcaaacaagtttcaattgaa |
29241301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University