View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15263_low_4 (Length: 367)
Name: NF15263_low_4
Description: NF15263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15263_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 106 - 344
Target Start/End: Original strand, 2176453 - 2176692
Alignment:
| Q |
106 |
agttagatgttgaaaatacaaattatcagtcannnnnnnatgttgctaaaactactttcatattgaaattgataagatatcaaattagcatttctctgtt |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176453 |
agttagatgttgaaaagacaaattatcagtcatttttttatgttgctaaaactactttcatattgaaattgataagatatcaaattagcatttctctgtt |
2176552 |
T |
 |
| Q |
206 |
cttgcaaaatgtgtagacaatatatacaatagtgtagtccaagtacttttggaactccc-aagactcacacagaaacacactaacactgcataccgtgtt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
2176553 |
cttgcaaaatgtgtagacaatatatacaatagtgtagtccaagtacttttgggactcccaaagactcacaaggaaacacactaacactggataccgtgtt |
2176652 |
T |
 |
| Q |
305 |
ctacggtgtctcgaaccaaatacatttgactttttgaata |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176653 |
ctacggtgtctcgaaccaaatacatttgactttttgaata |
2176692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 2176348 - 2176388
Alignment:
| Q |
1 |
ttaactgattgactcgaataaattgttcttagaagtaaaac |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176348 |
ttaactgattgactcgaataaattgttcttagaagtaaaac |
2176388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University