View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15264_high_13 (Length: 233)
Name: NF15264_high_13
Description: NF15264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15264_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 13393990 - 13394192
Alignment:
| Q |
13 |
gatgaatacaaatggaaaagaaaagggaactaaatctgaatgtgtatacaatagtaatgggaaagtgcctttgttatgtgctgcttctgcttttgttgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13393990 |
gatgaatacaaatggaaaagaaaagggaactaaatctgaatgtgtatacaatagtaatgggaaagtgcctttgttatgtgctgcttctgcttttgttgga |
13394089 |
T |
|
| Q |
113 |
ctagcaattgctttggttatggagcatacttacatgttgatagcagtgagtaaatcatcaccttctttaattaattgggatcctgattctccttctgcta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13394090 |
ctagcaattgctttggttatggagcatacttacatgttgatagcagtgagtaaatcatcaccttctttaattaattgggatcctgattctccttctgcta |
13394189 |
T |
|
| Q |
213 |
aat |
215 |
Q |
| |
|
||| |
|
|
| T |
13394190 |
aat |
13394192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 13397096 - 13397291
Alignment:
| Q |
14 |
atgaatacaaatggaaaagaaaagggaactaaatctgaatgtgtatacaatagtaatgggaaagtgcctttgttatgtgctgcttctgcttttgttggac |
113 |
Q |
| |
|
||||||| | |||||||||| |||||| ||||| |||||||| |||||| |||| || ||||| |||||| ||||| |||||| ||| |||||||||| |
|
|
| T |
13397096 |
atgaataaagatggaaaagataagggagataaatatgaatgtgcttacaatggtaacggtaaagtacctttgctatgttctgcttgtgcctttgttggac |
13397195 |
T |
|
| Q |
114 |
tagcaattgctttggttatggagcatacttacatgttgatagcagtgagtaaatcatcaccttctttaattaattgggatcctgattctccttctg |
209 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||||| |||||| |
|
|
| T |
13397196 |
tagcaattgccttggttatggagcatatttacatgttgatagcagtgagtaaatcaccaccttctttacttgattgggataatgattcttcttctg |
13397291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University