View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15267_low_4 (Length: 212)
Name: NF15267_low_4
Description: NF15267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15267_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 51 - 195
Target Start/End: Original strand, 14381726 - 14381870
Alignment:
| Q |
51 |
accttcattttcacacttggtaacactttcagttcccttgttttgcaagctttgtacttctgttggttcattctgatccttcttctttttcttctctttg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14381726 |
accttcattttcacacttggtaacactttcagttcccttgttttgcaagctttgtacttctgttggttcattctgatccttcttctttttcttctctttg |
14381825 |
T |
|
| Q |
151 |
ccggagctttttcccttcccgtcaagattctccggccacatctca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14381826 |
ccggagctttttcccttcccgtcaagattctccggccaaatctca |
14381870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University