View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15268_low_8 (Length: 234)
Name: NF15268_low_8
Description: NF15268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15268_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 84 - 221
Target Start/End: Complemental strand, 4647680 - 4647543
Alignment:
| Q |
84 |
gttattcagattgatttttcaatcacaaaatttttcaaaagatgcagaaatgtttgtattttatatgaatgggatgggatgagttcaagaaacatttgat |
183 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4647680 |
gttattcggattgatttttcaatcacaaaattcttcaaaagatgcagaaatttttgtattttatatgaatgggatgggatgagttcaagaaacatttgat |
4647581 |
T |
 |
| Q |
184 |
ggaaggaatgttgtggattgtgatatgttacctgtgat |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4647580 |
ggaaggaatgttgtggattgtgatatgctacctgtgat |
4647543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University