View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15268_low_9 (Length: 228)
Name: NF15268_low_9
Description: NF15268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15268_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 45338945 - 45339156
Alignment:
| Q |
1 |
agcgagaagtctactcttggttttccttctcccgctattttagcacacacgaggatgcgcgattttcagtctgcaattgccgcccctgcaaaagagaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45338945 |
agcgagaagtctactcttggttttccttctcccgctattttagcacgcacgaggatgcgcgattttcagtctgcaattgccgcccctgcaaaagagaatc |
45339044 |
T |
 |
| Q |
101 |
gcgttgcagaaggccttcattctggactacgctataaaccgttgcgattcacaacataatggaaaccacttatgatttttatcttacactaagtggatga |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45339045 |
gcgtcgcagaaggccttcattctggactacgctataaaccgttgcgattcacaacataatggaaaccacttatgatttttatcttacactaagtggatga |
45339144 |
T |
 |
| Q |
201 |
tcattcataaat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45339145 |
tcattcataaat |
45339156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University