View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15269_low_6 (Length: 341)
Name: NF15269_low_6
Description: NF15269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15269_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 8543071 - 8543250
Alignment:
| Q |
14 |
caccattgataaaaacactttcaaatgttattgttcaaatataggagcaaacacttctcatctctcatggtaatactacatagtattagaaatcttaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8543071 |
caccattgataaaaacactttcaaatgttattgttcaaatataggagcaaacacatctcatctctcatggtaatactacatagtattagaaatcttaaga |
8543170 |
T |
|
| Q |
114 |
aattttgtttccactagacaagcaagttaatcttagcatctacattcatgttgtcttcatccaaataccactcaatctca |
193 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8543171 |
aaatttgtttccactagacaagcaagttaatcttagcatctacattcatgttgtcttcatccaaataccactcaatctca |
8543250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 329
Target Start/End: Original strand, 8543286 - 8543389
Alignment:
| Q |
229 |
aaataactcttaaaagaatcaaatttatgcaa---ttgtgtctattgctcaaccaaacattacttcctacagaggttcccccgaggatcattaattccta |
325 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
8543286 |
aaataactcttaaaagaatcaaattgatgcaaatattgtgtctattgctcaaccaaacattacttcctacagaggttccctcgaggatcatctattccta |
8543385 |
T |
|
| Q |
326 |
tttt |
329 |
Q |
| |
|
|||| |
|
|
| T |
8543386 |
tttt |
8543389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 8542494 - 8542457
Alignment:
| Q |
156 |
cattcatgttgtcttcatccaaataccactcaatctca |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8542494 |
cattcatgttgtcttcatccaaatacctctcaatctca |
8542457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University