View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15269_low_7 (Length: 319)
Name: NF15269_low_7
Description: NF15269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15269_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 22 - 315
Target Start/End: Original strand, 39529129 - 39529423
Alignment:
| Q |
22 |
agacgattaacaaatttgtcaagatcctagca-gtaggaaagggggaaaagaaaatgcaaaagttgaaaccgaaacaacatgacaaagaagatatatttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
39529129 |
agacgattaacaaatttgtcaagatcctagcaagtaggaaagggggaaaagaaaatgcaaaagttgaaacctaaacaacatggcaaagaagatatgtttc |
39529228 |
T |
 |
| Q |
121 |
tattttaagtaaccttgcatgataagttggtaacagacataaacaaggagcattacaaactaagcatccttaacgtatcgcatccgatactcatatcttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529229 |
tattttaagtaaccttgcatgataagttggtaacagacataaacaaggagcattacaaactaagtatccttaacgtatcgcatccgatactcatatcttg |
39529328 |
T |
 |
| Q |
221 |
tttgtgcttcatcgacaaaaatggcaaaaatgtcataaatatgatcccttgaaaataattcctacaattgctaataaaagctcttcttctcactc |
315 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529329 |
tttgtgcttcgtcgacaaaaatggcaaaaatgtcataaatatgatcccttgaaaataattcctacaattgctaataaaagctcttcttctcactc |
39529423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University