View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526R-Insertion-10 (Length: 285)
Name: NF1526R-Insertion-10
Description: NF1526R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526R-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 285
Target Start/End: Complemental strand, 43429050 - 43428774
Alignment:
| Q |
8 |
acgaggcgttttgatcaaacatgtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacggtaactgtgaatag-n |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
43429050 |
acgaggcattttgatcaaacatgtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacgttaactatgaatagaa |
43428951 |
T |
|
| Q |
107 |
nnnnnntcaatgcatggaagaagaaggaaccaactcactcgatatcagaatttggagataagcgg-nnnnnnnnnnttactcttgttgtttctctagtca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
43428950 |
aaaaaatcaatgcatggaagaagaaggaaccaactcactcgatatcagaatttggagataagcggaaaaaaaaaaattactcttgttgtt--tcgagtca |
43428853 |
T |
|
| Q |
206 |
ccagaatccaaactggtcgtgggagatttggattctctctttctactcattctatcttttcccccatccaccaagttgta |
285 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43428852 |
cc-gaatccaaactggtcgtgggagatttggattctctctttctactcattctatcttttcccccattcaccaagttgta |
43428774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University