View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526R-Insertion-12 (Length: 233)
Name: NF1526R-Insertion-12
Description: NF1526R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526R-Insertion-12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 213
Target Start/End: Original strand, 8413647 - 8413848
Alignment:
| Q |
9 |
agtgcttctcggcgcgtgcttgtgagtcgccgccgattcagcaactcttcttcttcttcatcatcgttgataactttcttcactagatgccgttcgagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413647 |
agtgcttctcggcgcgtgcttgtgagtcgccgccgattcagcaactctt---cttcttcatcatcgttgataactttcttcactagatgccgttcgagaa |
8413743 |
T |
|
| Q |
109 |
gctcctcgatggtgtccggaccgtcgtgtaacaaccgccatgcgcaacagtttacggtttttggtttcagattcgaattccaaaggcttcgccattttcc |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413744 |
gctcctcgacggtgtccggaccgtcgtgtaacaaccgccatgcgcaacagtttacggtttttggtttcagattcgaattccaaaggcttcgccattttcc |
8413843 |
T |
|
| Q |
209 |
tctca |
213 |
Q |
| |
|
||||| |
|
|
| T |
8413844 |
tctca |
8413848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University