View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526R-Insertion-13 (Length: 195)
Name: NF1526R-Insertion-13
Description: NF1526R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526R-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 529590 - 529776
Alignment:
| Q |
9 |
aattttatcaattatttattgtcttgttaatttttaacaggttacatggattgaaaatgtagaagttgatgatcaggtggtgcaaaatatatataaacct |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
529590 |
aattttatcaattatttgttgtcttgttaatgtttaacaggttacatggattgaaaatgtagaagttgatgatcaggtggtgcaaaatatatataaacct |
529689 |
T |
|
| Q |
109 |
ctagttaattctggacttgcttttggagctaaacgctgggtagctacattacatcgacaaagcgatcgtcttgtttttagaacagcc |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
529690 |
ctagttaattctggacttgcatttggagctaaacgctgggtagctacattacatcgacaaagcgatcgtcttttttttagaacagcc |
529776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University