View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526_high_17 (Length: 212)
Name: NF1526_high_17
Description: NF1526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 41 - 164
Target Start/End: Complemental strand, 39688968 - 39688845
Alignment:
| Q |
41 |
acacatttcactttcacatttatctcaatggttacatattggtatcattgtgcaataattaatcaaagatatgttattatctatacaggtgaagaatgta |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39688968 |
acacatttcactttcacatttatctcaatggttacatattggtatcattgtgcaataattaatcaaagatatgttattatctacacaggtgaagaatgta |
39688869 |
T |
 |
| Q |
141 |
acactgttgttatcatagcatgga |
164 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39688868 |
acactgttgttatcatagcatgga |
39688845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University