View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526_high_6 (Length: 329)
Name: NF1526_high_6
Description: NF1526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 4592796 - 4592888
Alignment:
| Q |
19 |
ttttaattggcttgtaggagtgtgccatttcatttaggta-tcgttgatgatgtggccacgagtgtgccttcccaaatcgagcactcgtgatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4592796 |
ttttaattggcttgtaggagtgtgccatttcatttaggtactcgttgatgatgtggccacgagtgtgccttcccaaatcgagcactcgtgatg |
4592888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 274 - 319
Target Start/End: Original strand, 4593115 - 4593160
Alignment:
| Q |
274 |
ttccacatttctttggattttgttccaccacatccattttgttcat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4593115 |
ttccacatttctttggattttgttccaccacatccattttgttcat |
4593160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University