View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526_low_13 (Length: 251)
Name: NF1526_low_13
Description: NF1526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 48 - 251
Target Start/End: Original strand, 6751547 - 6751748
Alignment:
| Q |
48 |
tgttattataggttgccaatttttatttgttcaatttgaattggcaagtagatcatattaacaaaacgtgtgattatctcaacnnnnnnnnntgcgatta |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6751547 |
tgttattataggttgccaatttttatttgttcaatttgaattggcaagtagatcatattaacaaaacgtgtgattatctcaacaaaaaaaa-tgcgatta |
6751645 |
T |
|
| Q |
148 |
tgttgggtgaaatacttgacacagaatgctattgcattttacactcaaaatggccattaaattgaatatttaactgtattttgatgcctttttacatgct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6751646 |
tgttgggtgaaatacttgacacagaatgctattgcattttacactcaaaatggccattaaattgaata-ttaactgtattttgatgcctttttacatgct |
6751744 |
T |
|
| Q |
248 |
aaaa |
251 |
Q |
| |
|
|||| |
|
|
| T |
6751745 |
aaaa |
6751748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University