View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526_low_6 (Length: 329)
Name: NF1526_low_6
Description: NF1526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 319
Target Start/End: Original strand, 6436468 - 6436767
Alignment:
| Q |
19 |
ttgggtttatgaggtttttgtttgtttggtatctggggaaataaaatgaggggaattgagttgaaagttttgtttcactggatttatgcatgttagctta |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6436468 |
ttgggtttatgagggttttgtttgtttggtatctggggaaataaaatgaggggaattgagttgaaagttttgtttcactggatttatgcatgttagctta |
6436567 |
T |
 |
| Q |
119 |
actggttgattaaaatgagttgannnnnnnnnncgttgcatgtttgatatcaatgtggatttgtcgaaatcacagtgagctactgtgattttgcaaaagt |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6436568 |
actggttgattaaaatgagttgatttttttttt-gttgcatgtttgatatgaatgtggatttgtcgaaatcacagtgagctactgtgattttgcaaaagt |
6436666 |
T |
 |
| Q |
219 |
tttatgattttggcttctggctttttggattatagaggtctgttttgtttatgaggaaaaaattgagagaaaggagagattttatttgctttgttgatga |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6436667 |
tttatgattttggcttctggctttttggattatagaggtctcttttgtttatgaggaaaaaattgagagaaaggagagattttatttgctttgttgatga |
6436766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 35069131 - 35069175
Alignment:
| Q |
173 |
gtggatttgtcgaaatcacagtgagctactgtgattttgcaaaag |
217 |
Q |
| |
|
|||||||| || |||||||| ||||| |||||||||||||||||| |
|
|
| T |
35069131 |
gtggatttatcaaaatcacattgagccactgtgattttgcaaaag |
35069175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University