View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1526_low_9 (Length: 289)
Name: NF1526_low_9
Description: NF1526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1526_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 43428781 - 43429050
Alignment:
| Q |
1 |
tggtggatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattctggtgactagagaaacaacaagagtaannn |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
43428781 |
tggtgaatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattc-ggtgactcga--aacaacaagagtaattt |
43428877 |
T |
 |
| Q |
101 |
nnnnnn--ccgcttatctccaaattctgatatcgagtgagttggttccttcttcttccatgcattgannnnnnn-ctattcacagttaccgtgtgtttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
43428878 |
ttttttttccgcttatctccaaattctgatatcgagtgagttggttccttcttcttccatgcattgattttttttctattcatagttaacgtgtgtttgt |
43428977 |
T |
 |
| Q |
198 |
gtatgtatgcatgtatgtatgagctattcattttatttcgtaaccttgtacatgtttgatcaaaacgcctcgt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43428978 |
gtatgtatgcatgtatgtatgagctattcattttatttcgtaaccttgtacatgtttgatcaaaatgcctcgt |
43429050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University