View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15270_low_10 (Length: 236)
Name: NF15270_low_10
Description: NF15270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15270_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 34676045 - 34676247
Alignment:
| Q |
12 |
aaaaatttaataaaatggtaatatttttcaattttcagcttatcagaagagttaagagattacagttgattcaggtcgtctacccaaaatccttggccct |
111 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34676045 |
aaaaaattaataaaatggtaatattttt-------cagcttatcagaagagttaagagattacagttgattcaggtcgtctacccaaaatccttggccct |
34676137 |
T |
|
| Q |
112 |
aannnnnnncctagacaacctgcaaatata-ttagatgttaatcaaaatatcatatataaaccgatataacaagataagttatatttgaacaaccaaacg |
210 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34676138 |
aatttttttcctagacaacctgcaaatatatttagatgttaatcaaaatgtcatatataaaccgatataacaagataagttatatttgaacaaccaaatg |
34676237 |
T |
|
| Q |
211 |
tgacggagtt |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
34676238 |
tgacggagtt |
34676247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University