View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15270_low_11 (Length: 232)
Name: NF15270_low_11
Description: NF15270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15270_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 34676041 - 34675827
Alignment:
| Q |
16 |
tattttactt-gattttctattggtggctgaaaatgacatgactttttcataggtcccagaagttatataccaaactttagatgaaccacttggcaatga |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34676041 |
tattttactttgattttctattggtggctgaaaatgacatgactttttcataggtcccagaagtgatataccaaactttagatgaaccacttggcaatga |
34675942 |
T |
|
| Q |
115 |
tgaactaaagggaaggtttgatattccacaaactttagaggagttcatggttaaaatgaaggaaggtggatatgatgccaaaacatttgcagttaaactt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675941 |
tgaactaaagggaaggtttgatattccacaaactttagaagagttcatggttaaaatgaaggaaggtggatatgatgccaaaacatttgcagttaaactt |
34675842 |
T |
|
| Q |
215 |
agagaaatggtacaa |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34675841 |
agagaaatggtacaa |
34675827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University