View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15270_low_8 (Length: 303)
Name: NF15270_low_8
Description: NF15270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15270_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 42452826 - 42452559
Alignment:
| Q |
17 |
acctgtagcattcaatatccccatctcaaaaactccaatgtttggtctccagaccccattgtctgttggattcacatcagtgctgtaccgtggatcgtca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452826 |
acctgtagcattcaatatccccatctcaaaaactccaatgtttggtctccagaccccattgtctgttggattcacatcagtgctgtaccgtggatcgtca |
42452727 |
T |
 |
| Q |
117 |
tcaaacatatgatacccaccgtccaaagtgaccctcatactaagcttaccgacaaaaaatctttcattctgtataacatccatggttacaagacgatccg |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452726 |
tcaaacatatgatacccgccgtccaaagtgaccctcatactaagcttaccgacaaaaaatctttcattctgtataacatccatggttacaagacgatccg |
42452627 |
T |
 |
| Q |
217 |
gattttgtaatggtgtttgtgccttcttcacaggaaatacacatgtccctaacctcttgcaccttgcc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452626 |
gattttgtaatggtgtttgtgccttcttcacaggaaatacacatgtccctaacctcttgcaccttgcc |
42452559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University